Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13439H2
Clone ID IST13439H2
Vector VICTR74
Project tigm

Sequence tag IST13439H2HMF1
Sequence
CTTACATATAATAATAAATAAATCTTTAAAAAATTCATAATAAATGAAAAATATAACCAGTCTTCTTGGAACTCCTTTCC
AGTAACTCANACTGAAGACTAAGCTAGCTGCAAAGTTACAGTGATCCACCTCCCTCTGCCACCACCACCACCACCACTGC
CTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13439H2BBF1
Sequence
TTACATATAATAATAAATAAATCTTTAAAAAATTC
Sequence Type genomic DNA
Unitrap ID UNI33753 UNI33754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 120651418..120651451 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 87867145..87867178 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 120661600..120661633 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181386276..181386309 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002455 (Prpf6) NM_133701 PRP6 pre-mRNA splicing factor 6 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1922946]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 64894727..64894760 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3244929..3244962 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7851482..7851515 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032000 (Birc3) NM_007464 baculoviral IAP repeat-containing 3 Gene [Source:MGI (curated);Acc:Birc3-001]

 
Come back to gene ENSMUSG00000032000


For any suggestions or comments, please send an email to unitrap@crg.es