Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_262G2-3
Clone ID CMHD-GT_262G2-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_262G2-3
Sequence
GAACAGTGAGCAGAATGAACACATCCCTGGAACAGAGTGGCTGCTACAGTAATAGAGAAACTCTTCTGAGGTGCAGTGAT
GCAAGGAGGGAGCTGGAGCTTGCTATTGGTGGAGTACTTCGGGCTGAACAGC
Sequence Type mRNA
Unitrap ID UNI10778

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 120499437..120499568 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021908 (Ncoa4) nuclear receptor coactivator 4 Gene [Source:MGI Symbol;Acc:MGI:1350932]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32983934..32984065 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056234 (AC154532.3-202) NP_001029160 nuclear receptor coactivator 4 [Source:RefSeq peptide;Acc:NP_001029160]

 
Come back to gene ENSMUSG00000056234


For any suggestions or comments, please send an email to unitrap@crg.es