Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14579G7
Clone ID IST14579G7
Vector VICTR74
Project tigm

Sequence tag IST14579G7BBF1
Sequence
ATCCTGTCTCTGAACTATGATTCTGTAATTTAATCTAATGTCCTTTAAAAAAAAGCAGGCACGATTTGAATCCCAGCTTT
CAGTAGGTAAAGCCAAGCTGGTCTACACAGGGAGATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI30683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29118747..29118866 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]


Sequence tag IST14579G7HMF2
Sequence
TGAGTAACTTGTATCATGATACTGACCTATATTCTTACAAACGGTTAAATATAATGAATATTAAGTATATTTGACTACAT
TTTTTTTTAATCGGGCTGGGGCTTTATTTCAGCAATACAGCACTTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 65765589..65765716 128
NO GENE  

 
Come back to gene ENSMUSG00000024006


For any suggestions or comments, please send an email to unitrap@crg.es