Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_263E12-3
Clone ID CMHD-GT_263E12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_263E12-3
Sequence
GGAGAAAGGACCTGTGATTTACACCGTCACTCCTTCAGGCAGCCCGGCTCTGCGGACTGCGGCCCGTCGGCCCTGACAGC
TGGAGTCCTGGTTCACCTCCCATCTAGGAAGATGGTGTGGGGCTGGAAGCGGAGGCTTGGAGGAAAGAAAACGGGATAAA
CGGTCATGGAGAATCCCATCCTCACAGGGATTTGGCTCTTGCTCTGAGGGGACCCTCACAGATTCCATACGGGCGTGGCA
AGTCCAACCATCGCGTCTCTACCATGTCCCAAAGGCAGAGGAGAGGCTGTTGTTTGGAAAGGCAAAAATAATTCCCCAAA
CTTGGCCTTAATTGTATTGTTGACAAGATGGAGGAGGAACAGTTTACAGGAAGGCCTCCAACGCGCCCGCACACAGATGC
ACTTCCTGTGAAAGCACTGGTGCAGATGCTCTGAGTGTAAGCAGCCAGTGTCTTGGAGGCATCAGCAACCCTCCTTCATG
ACCTTATTAATAAAGTCCAAGATTCCCTTCGCAATTAAGAAGGGAGCATCC
Sequence Type mRNA
Unitrap ID UNI13695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116520612..116529701 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075410 (OTTMUSG00000003947) predicted gene, OTTMUSG00000003947 Gene [Source:MGI Symbol;Acc:MGI:3649529]

 
Come back to gene ENSMUSG00000075410


For any suggestions or comments, please send an email to unitrap@crg.es