Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10915F9
Clone ID IST10915F9
Vector VICTR76
Project tigm

Sequence tag IST10915F9BBF1
Sequence
CTANATTCCTGGCGTTGGCTTCACTAGACAGATGANCCAATTGACCTCCGGAGAGGTTGAGTAAGTAACTACATCTTGGT
GCCTGCCAGCTCAACAGCTTGGCAGCCTGATGTGTAGGCCCTACCCTGGCAGTGCCAGCCTTGTTANGAAAGGTACAAAG
AGAATATATGAGCCAGTGGGGGCTTGANTCAAGTTTTCCAACCAGCTGAGAGCANAGGGTTGCANTCCANGCAGGANAGT
TCGGGAGGAAGGGCGGTGCCCTGGGAAGGTGCCTTTGTGGCCCTGCTAAGTGAGGGTGCCTTGTACTTGGGATCT

Sequence Type genomic DNA
Unitrap ID UNI25917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73018207..73018520 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030513 (Pcsk6) proprotein convertase subtilisin/kexin type 6 Gene [Source:MGI Symbol;Acc:MGI:102897]


Sequence tag IST10915F9HMR1
Sequence
CTAGGACNNGCTAAACGCTGGATGTCATGGACCCNCCNNANNGNANTGNGGTGGNNNGNNNNNNTTGCCATACNNNTAAA
AACAGTCNCACCTGANACACAGAGAGATCANGATCCAAACTGTCNCNTCAAAGTCTAAGACTTTCACTAAAGTCTTAAAG
ACTCTCACTGAGGCTTAGAGCAGGCCAAACTCTTTCTCTGCCATCCTTCCTGCCTTCCGTTACTCCTTCTACCTCCACTC
GCTGCATTCTTTCGGTTCTTTGTCCNNTTANGAGCANAGGGTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10915F9HMF1
Sequence
TNNATTCCNGGCGTTGGCTTCACTANACANATGANCCAATTGACCTCCGGAGAGGTTGAGTAAGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000030513


For any suggestions or comments, please send an email to unitrap@crg.es