Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11035G9
Clone ID IST11035G9
Vector VICTR76
Project tigm

Sequence tag IST11035G9HMF1
Sequence
CCTCCGAGGCACCAGACACGAAGGTGGTGCAAGCAAATAAAAAAGATGGATGATGGGTCATAGATGGGTAGATACACAGA
AGGATGATGTAGAAAGTGGGAAGAAAAAGATGAAAAAAGAGAGAGACAGAGAGAACTAAAAATCCGGAATCTAACTAGGA
ACCACGATTACGCGTAGACTCCCAGGATCCCTCGCGCACGACGATGGGGCGTCCCGGGAGAAACTTGCAAAGGCCCGTCG
CGCTGCTCTCTGGGAACTGTANTCTCCGTGAAGAGAGGCGGGACTTATACGTAGCTGATCGGTACCCAATAAAAAAGCCN
AGAACTTAGACCGCTACTAGCTGTACCCAATGGAAGCACCGCATCAGGAGGGCGGGACTTCCGTCAGANACNATGGTGAG
AGCCTGCGCGAAAGACAACACTTCCTTTTGTGACTGGCGGTGAACGAGTGCGCAGTGCCNTGAAGGCCTCGGGCACGGTA
AGGANGCCGCGGCGGGGCAAAAGGTGCGGCGTTGGCGGCNNGGCCNNTCGGGTNGGCTGTGTCCTCNGGGGG
Sequence Type genomic DNA
Unitrap ID UNI11562

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73421184..73421734 527
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045128 (Rpl18a) NM_029751 ribosomal protein L18A Gene [Source:MGI Symbol;Acc:MGI:1924058]


Sequence tag IST11035G9BBF1
Sequence
CCTCCGAGGCACCAGACACGAAGGTGGTGCAAGCAAATAAAAAAGATGGATGATGGGTCATAGATGGGTAGATACACAGA
AGGATGATGTAGAAAGTGGGAAGAAAAAGATGAAAAAAGAGAGAGACAGAGAGAACTAAAAATCCGGAATCTAACTAGGA
ACCACGATTACGCGTAGACTCCCAGGATCT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73421546..73421734 189
NO GENE  

 
Come back to gene ENSMUSG00000045128


For any suggestions or comments, please send an email to unitrap@crg.es