Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_270D10-3
Clone ID CMHD-GT_270D10-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_270D10-3
Sequence
GTCCCTTACCTTAGTCCCTTAATGGTGTGGAAGGAACTTGAGAGCTTATTGGAGAATGAAGGTGACCATGCAATAACAGT
GGCAGACTTTGTGGACCATCACCCAATTGTCTTTTGGAACCTGGTGTGGTATTTTAGACGCCTCGACTTGCCCAGTAACC
TGCCTGGACTGATTCTTTCTTCTGAGCATTGTAACAAGTATTCAAAGATTCCCCGCCACTGTATGTCTGAAGATAGCAAG
TATGTTTTAATACAGATGTTATGGGACAACATGAAATTACATCAGGATCCAGGGCAACCCTTGTACATCCTCTGGAATGC
CCACAGTCAGAACCGCACTCTTCTGTTTGAGACTCAAAAGTACCCAATGGTCCATTTGTTACAAAAAGGTGATGACTCCT
TTAACCAGGAACTGGCTGAAAAGCATGGTGAAGAGCATTAAAATGAACGATGTCTATGGGCCCATGAGTCAGATTTTAGA
GACTCTGAATAAGTGTCCGCATTTTAAAAGACAGCGGAGTTTATATAGAGAAATATTATTTCTCTCACTTGTGGCACTGG
GAAGAGAAAACATTGATATAGATGCCTTTGACAAAGAATACACGATGGCTTATGATCCTCTCA
Sequence Type mRNA
Unitrap ID UNI13706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64757786..64764807 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035492 (Dennd4a) DENN/MADD domain containing 4A Gene [Source:MGI Symbol;Acc:MGI:2142979]

 
Come back to gene ENSMUSG00000035492


For any suggestions or comments, please send an email to unitrap@crg.es