Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_265B2-3
Clone ID CMHD-GT_265B2-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_265B2-3
Sequence
TTACCCATCTCCCAAGCCACCAACCAGTTTGTTCGCTATCACTTTCTTTATGCAAGATGGGACCCACAGTTCTTCCGACC
TTTGGAGTTCATCGAATGGGATGAGCCCGCCTGGTTTTGGTGGAATTCTGGGGACCTCCACATCCCACATGTCTCACTCC
AGTAGTTATGGCCGCCTTCATTCACATGACCGCTTGACTTATCCTCCACACTCAGTGTCACCCACAGACATAAACACCAG
TCCTCCGCCTATGTTCTGCTTCCACCGTGGTAGTACCAGCAGCTCATCATATGTTGCCGCCTCACATACTCCTCCCTTCA
ATGGATCATATATCATCCTACGAACCAGAGGGAATGTTGCTGGACCCTCACAGACGGCTGATGCTCTTGGGAAGGCCTTG
GCATCTATTTATTCCCCCGAC
Sequence Type mRNA
Unitrap ID UNI13708

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71730524..71733045 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032228 (Tcf12) NM_011544 transcription factor 12 Gene [Source:MGI Symbol;Acc:MGI:101877]

 
Come back to gene ENSMUSG00000032228


For any suggestions or comments, please send an email to unitrap@crg.es