Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_268E12-3
Clone ID CMHD-GT_268E12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_268E12-3
Sequence
TTGCAGACTCTCAGCGTTCTCATCTCTCCTCCTTCACCATGAAGCTGATGGACAAATTCCACTCTCCC
Sequence Type mRNA
Unitrap ID UNI13709

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29534647..29534714 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039844 (Rapgef1) NM_054050 Rap guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Rapgef1-001]

 
Come back to gene ENSMUSG00000039844


For any suggestions or comments, please send an email to unitrap@crg.es