Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14757C10
Clone ID IST14757C10
Vector VICTR76
Project tigm

Sequence tag IST14757C10BBF1
Sequence
AAAGAAGGTGGAGGTCCAGGCCCCATAATCACCCTCACAAGCATACCCCAATGACCCACGGGTCTCCCACAAGGCTCAAG
ATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 75185749..75185832 84
NO GENE  


Sequence tag IST14757C10HMF1
Sequence
CTTGCCAGCCATTTCAAAGGCCCTGGGTTACCCTCAGCACCAAAAGCAATCATAAGGATCAAACTGGAAGGGTTCCTGAT
GCCTCCCAACGCAGGCCAGTCGTCTCTTAAACAGCTCTTCCCCTTGTTCATCTGAGGAGACACATCTCTGAAGCTCACAG
GTCCCAGCCAGGGGAAGACCCCCTCATCCAGAAGCAACTGTCTCTAAAGCTCAGTTTCCAGACAGCCCTCATCTCCCTTC
TTGGAGTGCAGCTATAGGTGCCCCTGAATGTCTTTTCCANGAATTANCATTGTCCCGCCTCCCTGTTGTCTGTCCNANGA
ATGCNNNTGGA
Sequence Type genomic DNA
Unitrap ID UNI12986

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120714029..120714352 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048445 (Ccdc57) NM_027745 coiled-coil domain containing 57 Gene [Source:MGI (curated);Acc:Ccdc57-001]

 
Come back to gene ENSMUSG00000048445


For any suggestions or comments, please send an email to unitrap@crg.es