Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_268D7-3
Clone ID CMHD-GT_268D7-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_268D7-3
Sequence
TCTACTGCTGGCCAGCAACCCTTTAGGGAACCCGACTTCTTCCAGGAAAACGAAGAGGAAGCCTTTACATTGGCCCTACC
TGAGGGACCCCAGGAGTTCTACATGGACAGTCCCATGGAGAGCAGCCAAGGTCCGGAGGGCTCTGTCAAGGGTTGTGGCG
AGGAGAAGGAGCCTGAGCTGGGGGGCCTGTTCCTGCCAGATGACAAGTGCCTCGTCCTCTCTCCATCTGTGACCACATCA
GACCTTTCCACTCACTCCACCGCCTCTCTTATCAGCAACGAGGAGCAATTTGAAGACTATGGTGAGGGGGATGACGTGCA
CTGTGCTCCCAGCAGCCCATGCCCCGACGATGAGACCACAACCAATGTCTACTCAGATCTGGGATCTTCAGTGTCTTCCA
CTGCGGGACAGACCCCAAGGAAGATGCGATATGCCTACAACAGTGAGCTGCTGGACGTGTACCGCTCTCAGTGCTGCAAG
AAGATCAACCTGCTGAATGACCTGGAGGCCCCGGCTGAAAAACCTGAACGCCA
Sequence Type mRNA
Unitrap ID UNI13710

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79494308..79497855 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es