Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_268C1-3
Clone ID CMHD-GT_268C1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_268C1-3
Sequence
CACGGCTGCGGAGCTGGGTCAGAAGACCTCCTCCTCTTCGTCTTCCTCCTCTTCCTCTGCTCAGTCTAATCGTTCCTCAA
AAGTTTCGCTGCCTGAAATCCCAAAGGAAAAATATCCCGAGGAATTCAGCCTGCTCAATTCACAGACAGAAGATGGGCAG
CGTCCTGAGTGGACATTTTATCCAAGGTTCAGCAGCAACATCCACACCTACCACATTGGAAAGCAGTGCTTCTTCAATGG
GGTCTTCCGGGGCAACAGGAGGTCTGTGGCAGAGAGGACAGTGGACAACAGCCTCGGGAAGAAGAAATACGGTAGTGTGT
TTCCTCCATCAAAGGTGAAAAAAAAAAAAAGAAAAAAAAAAAAAAATGTTCACGAAATTGACTACTGATTTCTTCCAATC
CCCATCAACTTTGCCTCCGGCGAACTT
Sequence Type mRNA
Unitrap ID UNI13711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45591046..45598259 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es