Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_267G9-3
Clone ID CMHD-GT_267G9-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_267G9-3
Sequence
GGATAACTCCTCGGCCTGGACACAGCTGCTTGGACCAAACAAGCCATGAGTGCCGCCATGTTCTCCAAGCAGGCAGCACA
GAGGGCCCACACTCTGCTCGCCCCGCCCTCTGCCAGCAATGCCACCTTTGCCCGGGTACCTGTGGCAACTTACACCAACT
CCTCACAGCCCTTCCGACTGGGAGAGCGCAGCTTTAACCGGCAGTACGCCCATATTTATGCCACCCGCCTCATCCAGATG
AGACCGTTCCTGGTGAGCCGGGCGCAGCAACACTGGGGCAGCCGAGTTGAAGTGAAGAAGTTGTGTGAGCTGCAGCCTGG
GGAGCAGTGCTGTGTGGTGGGCACGCTGTTCAAAGCCATGTCCCTCCAACCCTCCATCCTGCGGGAGATCAGCGAGGAGC
ACAACCTGGTCCCCCAGCCTCCACGGAGCAAATATATCCACCCGGATGACGAGCTGGTCTTAGAAGATGAGCTGCAGCGT
ATCAAACTGAAAGGCACCATTGATGTGTCAAAGCTGGTCACAGGAACGGTCTTGGCCGTGTTGGGCTCTGCGAAAGATGA
CGGGAGGTTTCAGGTTGAAGACCACTGCTTTGCTGACCTGGCTCCACAGAAGCCGGTACCCCCACTTGACACAGACAGAT
TTGTGCTACTGGTATCCGGACTGGGCCTGGGCGGTGGTGGCGGGGAGAGCCTCCTGGGCACCCAGCTGCTGGTGGACGTG
GTGACGGGACAGCTTGAGGACGAAGGAGAACAGTGCAGTGCTGCCCACGTCTCTCGAGTCATCCTCG
Sequence Type mRNA
Unitrap ID UNI13715

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5774077..5776991 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020471 (Pold2) NM_008894 polymerase (DNA directed), delta 2, regulatory subunit Gene [Source:MGI (curated);Acc:Pold2-001]

 
Come back to gene ENSMUSG00000020471


For any suggestions or comments, please send an email to unitrap@crg.es