Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11497H2
Clone ID IST11497H2
Vector VICTR76
Project tigm

Sequence tag IST11497H2HMF1
Sequence
TTTGATACGACAAGAGAAAACTCCCTGGTTCANTTCTTGATATTTTTTAAGGACTGTTA
Sequence Type genomic DNA
Unitrap ID UNI33765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 46085251..46085306 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037712 (Plekhc1) NM_146054 fermitin family homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Plekhc1-001]


Sequence tag IST11497H2BBF1
Sequence
TTTGATACGACAAGAGAAAACTCCCTGGTTCANTTCTTGATATTTTTTAAGGACTGTTGACAGAACTTATGTATCCTCAC
ACATTTATTTTAACTTCACCACATCACTTCTCCCTTATTTGAAAAGTTCCACAAAAGGCCTTATAAGGTGACTATATGTA
NTATTTTTCCTANAAAGACTAGGACTCTACCTAANGTGCCCTTTCTTTCTTTCTTTTAATGGTTTAAACACTTCCCTGGA
GGTAGAGCTGANTCCAGGTCTGCATTTCCCAATCCTTGCTCTGCGCCCACTTGAGTGCCAANGCTGGANTAAGCCCCCTT
CCACCGAATANGGGTGTTCTTANNATGGGCACANTTNNNCANANTCNNACCTCNNNAGAATGAAGCTACTGTGTGGGCTC
ANGATTTCTTTTATGCNTTTCTGTAATTAAATTTATTTTTCTAGGATGTGAANTTACTCCGGATGTAAACATTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000037712


For any suggestions or comments, please send an email to unitrap@crg.es