Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12846C8
Clone ID IST12846C8
Vector VICTR76
Project tigm

Sequence tag IST12846C8HMR1
Sequence
NGGGAGAGGCACCAATGGTACATACTGCAGGTGAAGAGGCTCCCGCCTGTTCTGGAAATTGATCACATCAGCTAGATGTT
ACTCGCTTTGAAAAGTCCTTCTTTAAGTCCCTCTTTCCTGAGTTTGCCAGATCTACTCAGCATATACTAGAGTGCATAAA
AGGGCTCCTTTTATACAAAGTACTTAAATTAATATTCTAGGTCTAAACCACTATAATATCTTGCACTAAAAGCCAGTAAA
TGTATTTGTTGGATCTTGTAAGAAAAAAATAGTAAATTCTGGAGCAGTAGAAGAAAAGTCTTTGGGTGCCCTGCCCTGAG
GAAGGAGCAGGCTGGCAGGTGGACTCCTTGGCTGTCTGGTCTGCTAATCACATCAGTGACACCAGAGTCCTCCTAAGCCG
TGTTCTGTACATGTCCCTCTGGGGCCTAGAGAGGAGAAGGGCACATCTCATGAGGCCGTGAAAGATAATGGAAAGGCATG
GCTTCACTATGCTTTATCANGCCTTAAATCCCCCTTANAGTCCTAACCTCTCTTCTATATGGATNNAAAGTTACTGTCAC
TTGTGTTTATAGCAAAGGAATGTTTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI3913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 149321861..149322447 578
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001687 (Ubl3) NM_011908 ubiquitin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1344373]

 
Come back to gene ENSMUSG00000001687


For any suggestions or comments, please send an email to unitrap@crg.es