Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_247F4-3
Clone ID CMHD-GT_247F4-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_247F4-3
Sequence
ACACATCCCTGGAAGGCATGTGTGGCACTGAGCATGCCCAGCTGGGGGAAGATGGGCAGCGGCCGCCGCGGTGCACTTCA
ACTACCTCATCTCAGTCTGAGCCTTCAGAGCAGCTTAGGCACCAAGGCAAGATCCTAGCATCCGAGGACCCCAAAAAGAA
GCGAGCTCAGAAGCCCTCTCACATGAGAAGAAACATACGAAAGCTACTCCGGGAGGATCAGTTGGAGCCCGTAACCAAAG
CAGCACAGCAGGAAAAATTGG
Sequence Type mRNA
Unitrap ID UNI5981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106622734..106625245 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]

 
Come back to gene ENSMUSG00000040661


For any suggestions or comments, please send an email to unitrap@crg.es