Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_269F11-3
Clone ID CMHD-GT_269F11-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_269F11-3
Sequence
GGCACGTTAGATGATGCGGATGACCCAAGCACAAGTGTGGGAGCCTATCACTACATGCTGGAGTCAAACATGGGGAAGAC
TATGCTGGAGTTTCAGGAACTAATGACCATTTTCCAACTACTGCACTGGAATGGAAGCCTGAAAGCCCTCCGTGAAACAA
AGTGCTCTCGACAGGAAGTCATCTCCTACTATTCCCAATATTCTTTAAATGAAAAGATGCGTAGCCACATGGCCCTGGAC
TGGATTATGAAGGAGCGTGAATCACCAGGAATTCTCTCTCAAGAGCTGCGTGCAGCCCTAGGGCAGCTGGAGGAAGCCAG
GAAGGCTGGACAAGAACTACGATTTTACC
Sequence Type mRNA
Unitrap ID UNI13725

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17582932..17594243 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047786 (Lix1) NM_025681 limb expression 1 homolog (chicken) Gene [Source:MGI (curated);Acc:Lix1-001]

 
Come back to gene ENSMUSG00000047786


For any suggestions or comments, please send an email to unitrap@crg.es