Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14243G2
Clone ID IST14243G2
Vector VICTR74
Project tigm

Sequence tag IST14243G2HMF1
Sequence
AAAGTACTATATCAGAAATCCTAAGCCTTCGGGTTACTCCGTTCAATGCCCGCCCCTGCACAAGCCTGTCCCAGAAACAA
TCCTCCCCCTCTTGACCCCAAGCCGGGGACTTCCCTTATATTACGAAACATGCTCCGGAGCTACGCAAAGCATCGCCTGC
CTACACACTTTTCAAGGCAACGCCTGGTAGGTGCTCTTGCTCCCCATTTCACAGATGAGGAGACTGAGGGATCAGAGAGG
CNNNNCNCCTNNCAGGGAGCAGGAGCAAGCGGGGGAGGGGGGAATCTTGTNGTGTTTGTTTACAGGGCGGAGCCTGAAAG
GGTCTCCCGGGAGGGTCCCCTTGTANCCTGTGCGTGCGCCANACATCTNNTTCGGCTCGGANTGNCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32463091..32463478 360
NO GENE  


Sequence tag IST14243G2BBF1
Sequence
AAAGTACTATATCAGAAATCCTAAGCCTTCGGGTTACTCCGTTCAATGCCCGCCCCTGCACAAGCCTGTCCCAGAAACAA
TCCTCCCCCTCTTGACCCCAAGCCGGGGACTTCCCTTATATTACGAAACATGCTCCGGAGCTACGCAAAGCATCGCCTGC
CTACACACTTTTCAAGGCAACGCCTGGTAGGTGCTCTTGCTCCCCATTTCACAGATGAGGAGACTGAGGGATCAGAGAGG
CAACGCGCCTCGCAGGGAGCAGGAGCAAGCGGGGGAGGGGGGAATCTTGTAGTGTTTGTTTACAGGGCGGAGCCTGAAAG
GGTCTCCCGGGAGGGTCCCCTTGTANCCTGTGCGTGCGCCANACATCTANTTCGGCTCGGAGTGGCCANGCCTGGTGGGG
AGCTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32463073..32463478 398
NO GENE  


Sequence tag IST14243G2HMR1
Sequence
NTTNNAGCCTTCGGCTCTCCTTTTCACAAATGCATGCATCTTTCCAGTCGCCCCAGGAGTTACCAGTTCTTANTCCCATT
TCACAGATGAGGAAACTGAGGCTCANAGAGGTCACATGGCTTGCTCGAGGCCCCCCAGCCAGTAAGTGTGGACCCGACAT
TCGCACTGGCACCTGATACGCTGTTCTGACCNTGGCGTTCTCAGAGCAGGACCGTGACGGGCCTGACCGGGGGAACCGTA
NTCCTGGCTGAGGGCACTGCTCANGCAAAGGTGGGAAAGTGGGGCGTGGGCCTGGGACCTGGAGTGCTCCAAGTGTCTGG
AGCACGGGGCATGCGCAAGACAGGGTANTAANACGGTGGN
Sequence Type genomic DNA
Unitrap ID UNI33774

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32463481..32463834 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026811 (St6galnac6) NM_001025310 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 Gene [Source:MGI (curated);Acc:St6galnac6-001]

 
Come back to gene ENSMUSG00000026811


For any suggestions or comments, please send an email to unitrap@crg.es