Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_261G1-3
Clone ID CMHD-GT_261G1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_261G1-3
Sequence
GCGGTGGTGGATGGTGCCTTCCAGGACATCCCGCTTTCGGACATACAGAGGGAAGTACGTGGTCCTCTTTTTCTACCCAC
TGGACTTCACTTTTGTTTGCCCCACGGACATCATCGCTTTTAGCGACCATGCTGAGGACTTCCGAAAGCTAGGGTGTGAG
GTGCTGGGAGTGTCTGTGGACTCTCCGTTCACCCACCTGGCGCGGATCAATACCCCACGGAAAGAGGGAGGCTTGGGCCC
CCTGAATATCCCTCTGCTTGCTGACGTGACTAAAAGCTTGTCCCAGAATTACGGCGTGTTGAAAAATGATGAGGGCATTG
CTTACAGGGGTCTCTTTATCATCGATGCCAAGGGTGTCCCTCGCCAGATCACAGTCAACGACCTACCTGTGGGCCGCTCT
GTACACGAGGCTCTCCGCCTAGTCCAGGCCTTTCAGTATACAAACGAGCATGGGGAAGTCTGCCCTGCTGGCTGGAAGCC
CGGCAGTGACACCATCAAGCCCAATGTGGATGACAGCAAGGAATACTTCTCCAAACACAACTGAGATGGGTAAACATCGG
GGAGCCTGAAGCTTGGATTTCACCTGTGCCCCGACCTGGATGTCCTGTGCTGGCCCAAAAAATGCTAGATTTTCCTCCAC
TCTCTGAAGGGGCTGGAGTCTAGGCTGAGGCTTTCT
Sequence Type mRNA
Unitrap ID UNI13729

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87494195..87498116 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005161 (Prdx2) NM_011563 peroxiredoxin 2 Gene [Source:MGI (curated);Acc:Prdx2-003]

 
Come back to gene ENSMUSG00000005161


For any suggestions or comments, please send an email to unitrap@crg.es