Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15077B4
Clone ID IST15077B4
Vector VICTR80
Project tigm

Sequence tag IST15077B4HMR1
Sequence
GGGATCTCTGCAGCAAGTCAGCTACTGCCCGCCCCCAGCACATTCGAAGGGTAAGTAGTCGATTCCACAGGATCCAGTGT
ACAAACCTGAATGTAAAAGTCCTGGTGATGCCCACCTGGACTGGGAGTACCTCANAGGAAGTGGACGGGGCTCTGAGAGA
GGCAGCACACAGCAGGCTGCCCCAAATGACTGCAGCTGCAGGTGATAAAAACAGCCATCATGTGGGAAGGGGCACAGGTT
GTAACTGCTGCTTTGTGCTGTCTCCCGCCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI24858

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57655313..57655585 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004661 (Arid3b) NM_019689 AT rich interactive domain 3B (BRIGHT-like) Gene [Source:MGI Symbol;Acc:MGI:1930768]


Sequence tag IST15077B4HMF1
Sequence
ATCCCAACTAAGGAGACCTACACCTTGAATGCCCTATATCCCACCGTGAAGAGTAACAAATAAGACAAAGACAGCTTGCC
TCACACAATCAACAGTGTAACCTGCTTCCCAGGTCACCAGACCCACACTCTAACCTAGGCAGCTAGGAGCCAACAGTGGT
CCGGGAAGGAGGTCCTGGGTCTGCCTTGGCCGCTGTCCCTGTGCTCCTGCACAGGGTGGGCTCCTAGGGCTCACCTCTAT
GCTCGGAAGCAGGAGATGGCGGGGAGCTTGAGACTCTACCTGGCAAAAGCCAACCCTAAAACCATGTAATATGATTTCCA
CGGAGGTCATTTTTGTTGGTTTGGTTTATTTTTCCTACATTGAAAACTTTCCATGACAAGGAAGTGGCTCTTTCTANANG
GCAATTTGTCCCCACAGGACATTTACAATATCTACAGGCAGAACTTCTTTGANACANNANTTTTTGTANCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57655581..57656052 458
 
EST/CDNA Est Name
  CK622063.1 - CF726051.1 - BQ946382.1 - CV784430.1 - CN529161.1 - CN697072.1 - BY195371.1


Sequence tag IST15077B4BBF1
Sequence
ATCCCAACTAAGGAGACCTACACCTTGAATGCCCTATATCCCACCGTGAAGAGTAACAAATAAGACAAAGACAGCTTGCC
TCACACAATCAACAGTGTAACCTGCTTCCCAGGTCACCAGACCCACACTCTAACCTAGGCAGCTAGGAGCCAACAGTGGT
CCGGGAAGGAGGTCCTGGGTCTGCCTTGGCCGCTGTCCCTGTGCTCCTGCACAGGGTGGGCTCCTAGGGCTCACCTCTAT
GCTCGGAAGCAGGAGATGGCGGGGAGCTTGAGACTCTACCTGGCAAAAGCCAACCCTAAAACCATGTAATATGATTTCCA
CGGAGGTCATTTTTGTTGGTTTGGTTNATTTTTCCTACATTGAAAACTTTCCATGACAAGGAAGTGGCTCTTTCTAGAGG
GCAATTTGTCCCCNCAGGANATTTACAATATCTACAGGCAGAACTTCTTTGANACAGNATTTTTTTGTANCACNNNCTGG
CTTCNNNNANNNNACACAGCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57655581..57656081 464
 
EST/CDNA Est Name
  CK622063.1 - CF726051.1 - BQ946382.1 - CV784430.1 - CN529161.1 - CN697072.1 - BY195371.1

 
Come back to gene CK622063.1 - CF726051.1 - BQ946382.1 - CV784430.1 - CN529161.1 - CN697072.1 - BY195371.1


For any suggestions or comments, please send an email to unitrap@crg.es