Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11284E1
Clone ID IST11284E1
Vector VICTR76
Project tigm

Sequence tag IST11284E1HMF1
Sequence
ATCTCTCCCGGTCCTCTTGGAGCANAGCTATCTANTGTGCACAGTGTGCCANTTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11284E1BBF1
Sequence
ATCTCTCCCGGTCCTCTTGGAGCAGAGCTATCTANTGTGCACAGTGTGCCAGTTTGGCCACATCTCCTTGCCCACAAGTA
CCTTGGCAACATACATTCTTCTCCAGGGGACTGAGAGGAGGACCCCGCCTGGCGTACCGGAAGTCTTCCGTTGGTACCAC
TANAGTTTAGCTAGCCTTACATTACTCCTACCCTCCTCTCCCTCCCTCACCTNANCCCAACCAGTTTGAATCTCACTCTT
TGGCCNNGTCCTGGTGAAACTGT
Sequence Type genomic DNA
Unitrap ID UNI31828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88372355..88372617 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008604 (Ubqln4) NM_033526 ubiquilin 4 Gene [Source:MGI Symbol;Acc:MGI:2150152]

 
Come back to gene ENSMUSG00000008604


For any suggestions or comments, please send an email to unitrap@crg.es