Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14939H7
Clone ID IST14939H7
Vector VICTR76
Project tigm

Sequence tag IST14939H7HMR1
Sequence
ATGGCACACTGACCCGTTTGCAGTCAATCGCCTGCCAGTACGAGAAAAATAAGCTGCCTAGTGTTTCCTCGCATTTTAAG
ACTTAAACCTTGCAAGCCATGTGTCGTGAGTATGCTATGTCAGAAACATAAAGGGACACGTTTGTCTTTTCACAGTGCCA
GGCACAATGTCTTTCACAATGGAAGTACAGATTCACAAACTGGGTTTCGTTGGCTGCAATTTTGCCAAGATTTCGAGATT
TCCCTTGACAG
Sequence Type genomic DNA
Unitrap ID UNI21533

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29406344..29406594 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052712 (BC004004) NM_030561 Uncharacterized protein C6orf89 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q99KU6]


Sequence tag IST14939H7BBF1
Sequence
AGCTTTATTAAATACTGGTCAGGAGGAGGGACACTGGCTGGGTCCATCCCCAGAATATCCTGAGAATAACTGTGAATTAT
GTTAGGTGCTTACAGAGGCAAACCCCACAAGGCTATGGACTTCTGTCTTCATCCAACTGGGGGGCAAGCATGTATTCTGA
CATTTCCTGCCTTCATACCTCCCACCTACTTGTGATCAAGCACAAGCTGTGCAGTTGGGACAACCAAGCTTGTCTACAGA
CGTGAGAACACGTGGCTTGTTTTCCTANATGAACANCCCCGGGCATCCNANGAAGCTCTCTCTCCTTANGCAAGTGGGGA
GCGCAGGTTANGGGCATTTCTGTTTNNTANATCN
Sequence Type genomic DNA
Unitrap ID UNI12962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96492646..96492998 335
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es