Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12184G6
Clone ID IST12184G6
Vector VICTR76
Project tigm

Sequence tag IST12184G6BBR1
Sequence
TCTTCTGGATCTATTGATTTGAGTTGGTGATACTGTTGGGTCANANNTN
Sequence Type genomic DNA
Unitrap ID UNI30769 UNI30770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 61001837..61001879 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003228 (Grk5) NM_018869 G protein-coupled receptor kinase 5 Gene [Source:MGI Symbol;Acc:MGI:109161]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 82871030..82871072 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 93698452..93698494 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99756980..99757022 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6650175..6650217 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 62295031..62295073 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041729 (Coro2b) NM_175484 coronin, actin binding protein, 2B Gene [Source:MGI (curated);Acc:Coro2b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 54912676..54912718 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 50140091..50140133 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44397710..44397752 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30408132..30408174 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23206983..23207025 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 101536512..101536554 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 15059362..15059404 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 57067573..57067615 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 172879688..172879730 43
NO GENE  


Sequence tag IST12184G6HMR2
Sequence
AACCNTAAGTACGAATACATACAACATAAACGAGCATTAAATAAAGACAATACCGTGACCTCTAAGTCTCTCAAGTGCCA
ATTTACAGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 63161682..63161771 88
NO GENE  

 
Come back to gene ENSMUSG00000041729


For any suggestions or comments, please send an email to unitrap@crg.es