Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11631B4
Clone ID IST11631B4
Vector VICTR76
Project tigm

Sequence tag IST11631B4HMR1
Sequence
TTCTAAACCCACCACTGCCTTTCGCATCTGAGCCNTGGAGAGGGGGCCCCTTGAATGTGTCTTTCTTCTCAGGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165706294..165706369 74
NO GENE  


Sequence tag IST11631B4HMF1
Sequence
AAGCCTTCATGGTTGTTCTTCAAATGCAAAAGCAACTCAGGAGTTACCCTTGGCCTCAGGTTGCTGGGCTCANTCGGGCT
GCCCTTCCCCCTCCTCGGCTTCAGCTCTCCCTTCCAGACAAACAGGGAGGCCCTGCCAACGCTGCANCTCGCAGGCTGCC
AGGCCGGCCTTCCTACCCGGATCACCTACCTGCAGGCCGGCTCCCAGCCAGCGGCCAGGCCTCGCCCGGCTCANCCTTGG
GCATGGCGCCCTTCTTTCTCCTAGGTGCTGAAAAGGTGTCACCTTGAAGCTCCTTGCTCCTANTGCTANAGGGATTCTGA
AACTCTCANACCTTANCAGTCAATAACATTGGA
Sequence Type genomic DNA
Unitrap ID UNI29489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165705944..165706295 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es