Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13945A1
Clone ID IST13945A1
Vector VICTR74
Project tigm

Sequence tag IST13945A1HMF1
Sequence
ATCCCTGCCAGGCTATCTGCCCATCTTCCAGCTCCATGGAGGATCCCCTGAAAAGGAACCAAGTGGGGCCACAAGG
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117084631..117084706 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST13945A1BBF1
Sequence
ATCCCTGCCAGGCTATCTGCCCATCTTCCAGCTCCATGGAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117084662..117084706 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es