Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_255A4-3
Clone ID CMHD-GT_255A4-3
Vector pNMDi3
Project cmhd

Sequence tag CMHD-GT_255A4-3
Sequence
TCGTCTTGAGAAACTTTCAACCACTAATATGTCAGTCCAAGAAGAGATTGTAAGCAAGCACAACCAATTGAGACGAATGG
TTTCTCCATCTGGCAGTGACTTACTAAAAATGGAATGGAACTATGATGCTCAAGTGAATGCTCAGCAATGGGCAGACAAG
TGTACATTCACTCACAGTCCTATAGAACTCAGGACAACTAATTTAAGATGTGGGGATAATTTGTTCATGGCATCTTACCT
TGCATCAAGGTCTTCTGCAATCCAAGGATGGTATAATGAATACAAAGATCTTACATATGATGTTGGCCCAAAGCAACCTG
ATAGTGTGGTTGGACATTATACTCAAGTTGTTTGGAACTCAACTTTCCAAGTTGCATGTGGAGTTGCTGAATGCCCTAAA
AATCCACTGAGATACTATTATGTTTGTCACTATTGTCCTGTTGGCAATTATCAAGGAAGGCTATACACACCTTACACTGC
AGGAGAACCGTGTGCCAGTTGTCCTGATCACTGTGAAGATGGGCTATGCACCAATAGTTGTGGACATGAAGATAAGTATA
CTAACTGTAAATATCTGAAGAAGATGCTATCCTGTGAACATGAACTTCTTAAAAAAGGTTGCAAAGCTACATGCCTCTGT
GAAGGCAAAATTCACTAAATTTCCTGTACTCGTAGCCAGGACCATGTAGAGAAAGCTCATACTCTCTAGTTAGGCTTATC
ACATCCCACCAAGAAAGTAT
Sequence Type mRNA
Unitrap ID UNI13751

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 40431251..40445917 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025431 (Crisp1) NM_009638 cysteine-rich secretory protein 1 Gene [Source:MGI Symbol;Acc:MGI:102553]

 
Come back to gene ENSMUSG00000025431


For any suggestions or comments, please send an email to unitrap@crg.es