Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14308H4
Clone ID IST14308H4
Vector VICTR74
Project tigm

Sequence tag IST14308H4HMR1
Sequence
GGGCTTCGCTGANTCTCAAAGCTAGAGAGTGCAGTGGTTCTCAACCTTCCTGATGCTTCACCCCTTTAACACAGTGAGTG
CCTCATGTTGTGGAGAACCCTAATCGCGAAATTGTTACTCCACAACCATAATTTCGCTGCTGTTATGAGCTGTAATGTAA
ATATCTGATGTGCGGGCTCTCTGATATTGCACCACTGCTATAGAGGATCANAACCCATGCATGACTACCAACCAGTGACT
GGCTGTGGCTGACCTTCTCTGGTACAAACTGGCTTTGGGAAATACTGGGGATGGCTCCCCTTCTANCCNNTGANCAGTTT
GTCACATNCN
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30919858..30920184 315
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14308H4HMF1
Sequence
GCCCTAACAACAAAAGAGGCTTGATTTCTTTCCATGGCAACACCTAAGGGGACACCGCACAACCAACCCTTCAAAAATTG
AGGGAGCTGGGCTACAAATTCTTCTCACCTCTCACCAATTGACTAACACTCCTTCAAGGATCTCAACAACTCACTGCAGG
AAAACAAGCACTTCCACAAAAGTGCAGAAACTTCTCTCTGAGAGTTTCCAGAATCCCAAACCATGGGGTAAGGGCTGGCA
AGATGGCTCGGTGGGTAAAGGCGCCTGTTGCTAAGCCTGATGCCTGAGGTCCATTCCAGGGTCTCACATAAAGAAAGGAG
AGAACCAACAATACTTGTCGTCATGAACACACACACACACACACACACACACACACACACACANANANAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30920181..30920563 383
 
EST/CDNA Est Name
  CK636270.1 - CF535965.1 - CO431220.1 - DT919270.1 - CB523244.1 - CF744396.1 - BY090554.1

 
Come back to gene CK636270.1 - CF535965.1 - CO431220.1 - DT919270.1 - CB523244.1 - CF744396.1 - BY090554.1


For any suggestions or comments, please send an email to unitrap@crg.es