Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10454H4
Clone ID IST10454H4
Vector VICTR76
Project tigm

Sequence tag IST10454H4HMR1
Sequence
GGGAGGGTAGAAGGGAGCTGGCATTTANAACTCTCTGGTTCTGACCCACGAAATGCTACTTTAGCCTGGAACCTGACCAG
TTCCACTCCTAATTCCCAACTCTACCGCCAGTATCTGTGGAAGACCCTGTCCTTTGCCACCACTGCCCTCTGGGTCTGAC
TGGCACATCCCAGCCTGCTCGAGCTAGTTCTCCCTTGAACCACACTTTTCANAGCCTACACTGCCAGGTTACAAAAGCTG
TGCANCCCCTCCCTGANAAAGGTATTGGACCTCCCTCCTGANTGCCCC
Sequence Type genomic DNA
Unitrap ID UNI15981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4599535..4599822 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014303 (Glis2) NM_031184 GLIS family zinc finger 2 Gene [Source:MGI (curated);Acc:Glis2-001]

 
Come back to gene ENSMUSG00000014303


For any suggestions or comments, please send an email to unitrap@crg.es