Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12315D12
Clone ID IST12315D12
Vector VICTR76
Project tigm

Sequence tag IST12315D12HMF2
Sequence
GTTTTGGTTTTGGTTTTTTTAGAGACAGGGTTTCTCTATAGCCCTGGCTGTCCTGGAACTCACTTTTGTAGACCAGGCTG
GCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCTATGATGGATCAAAGGTGTGTGCCACCACACCCAGTGAGTTGGTAT
AAGATATATACATATATGTGTGCTTATCCAATCTAGGATATTGTGTTCTAACTCTTTCTAAAGCACATTTGGAAACAAGT
GACAAATATCTCACATTGACATGACAAACCATGACATGCNAGTTGGGACAGGTCTCCAGGCTGGAACTTGGGAGCTTTTC
TGTAATACTTCCCTTCTCTTATTTTCNGATTCTGCTCTAGGTTTTCNNATAATAATTCTAAAAACATTCCTGANNGGCTG
AACCCNNGAATTCTGCTAGGATTTCCCANCCTGCCGCTCTCCCATCTTTTTATTCCCACAGATGGAAAANGATGAGTTAC
TCAGTCTATTCTAAAANCTN
Sequence Type genomic DNA
Unitrap ID UNI30976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37123825..37124323 475
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024459 (D130003B22Rik) NP_001108547 histocompatibility 2, M region locus 6, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:95918]


Sequence tag IST12315D12BBF1
Sequence
NNNTNGGTTTTGGTTTTTTTAGAGACAGGGTTTCTCTATAGCCCTGGCTGTCCTGGANCNNANTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024459


For any suggestions or comments, please send an email to unitrap@crg.es