Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_270F8-3
Clone ID CMHD-GT_270F8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_270F8-3
Sequence
AGAAGATGGTGAATTAGAAGATGGAGAAATAGATGATGCAGGATTTGAAGAAACACCAGATCAGGAAGC
Sequence Type mRNA
Unitrap ID UNI13759

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128816827..128816895 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042851 (Zc3h6) NP_848491 zinc finger CCCH type containing 6 Gene [Source:MGI (curated);Acc:Zc3h6-001]

 
Come back to gene ENSMUSG00000042851


For any suggestions or comments, please send an email to unitrap@crg.es