Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10728F2
Clone ID IST10728F2
Vector VICTR76
Project tigm

Sequence tag IST10728F2HMR1
Sequence
TTAAAACCCCAGGCCATGCATGGTGGTACTCATCTTCATCCCAGCCCTCGGGAAGCAGAGGCAGCTGGATTTGAGCTCGA
GGCCAGCCTGGTCTACACAGTGAGTTCCAGGACAGCCAGGGCTACATAGTGAGACCCTGTCTCAAAAACAAAGCAATAAG
GAGGTTGTATTAGTAGTAGGTTTCTCTGGGTAGTCCTGGCTGTCTTGGC
Sequence Type genomic DNA
Unitrap ID UNI6070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29690156..29690363 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]


Sequence tag IST10728F2HMF1
Sequence
CTTTGAGAAGCTTCATTTGAGAATTCCTTGTTTCTTCTCAAGGCCACTAAGGCTATGTGACTGTCAAACTACAGTTACCT
TTATTTATTATCTGTGGATCGTTCCCTAACAGGGACATACAATCCAGCTACCCTGACATTTAACGTTGGCTGCTTTCTGT
CCCAGCTCAACACAGTCAAGTGTTCTTCANGTCATANTGAGAGCANACAGACCCATGAAAATTAACTACCAACAGCCACC
AATTTGAAAACAAGGACCGGGCTGGTGANATGGCTCANTGGGTAAGAGCACCCGACTGCTCTTCCGAANGTCCAGAGTTC
AAATCCCANCAACCACATGGTGGCTCACAACCNCCCGTAATGAGATCTGATGCCCTCTTCTGGTGCGTCTGAAGACAGCT
ACAGTGTACTTACATTNNATAAATAAATAAATAAATTAATTAATTAAAAAAAAAAAANNANAANNNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29689669..29690125 437
 
EST/CDNA Est Name
  AI324813.1

 
Come back to gene AI324813.1


For any suggestions or comments, please send an email to unitrap@crg.es