Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_268D2-3
Clone ID CMHD-GT_268D2-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_268D2-3
Sequence
TGCAGGGTACAGCATGTTTGCTGTGGGCATCGGGGCCTTGATCTTTGGCTACTGGAGAATGATGAGGTGGAACCAGGAGC
GCAGGCGCCTGCTGATTGAGGACTTGGAGGCCAGGATCGCCCTCATGCCGCTCTTCCAGGCAGAGAAGGACCGGAGGACC
CTGCAGATTCTCCGGGAAAACCTGGAGGAGGAAGCCATCATCATGAAGGATGTGCCCAACTGGAAGGTGGGCGAGTCTGT
GTTCCACACCACACGATGGGTGCCACCCCTCATTGGCGAGATGTATGGGTTGCGCACCAAGGAGGAGATGAGCAATGCCA
ACTTCGGCTTCACCTGGTACACTTAGGGCCTGAGCCAACGCACATAATAAAGAGTGGTCAAATG
Sequence Type mRNA
Unitrap ID UNI3074

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72418083..72419224 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036199 (Ndufa13) NM_023312 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 Gene [Source:MGI Symbol;Acc:MGI:1914434]

 
Come back to gene ENSMUSG00000036199


For any suggestions or comments, please send an email to unitrap@crg.es