Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14793B10
Clone ID IST14793B10
Vector VICTR76
Project tigm

Sequence tag IST14793B10HMR1
Sequence
GTTAATGCATGTTGCACTATAACCCCGTGTAGATTTAAAGATGGGGATTAGGAAAGCCGGCTTATTAAATATAACTCAGC
CACTAAAACTATGCCAGTGAGGAGAGTGCACGCGTCCCCTCTCTCCTCTGGCCAT
Sequence Type genomic DNA
Unitrap ID UNI6239

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 91558982..91559115 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031665 (Sall1) NM_021390 sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]


Sequence tag IST14793B10BBF1
Sequence
TTAACAACACCAAACAAATCGCAGTTGTAGCAGAAAATACCAATAATGATCCAGTTTTAATTTAATGTTTAATCATCCTA
ATTGGCACCAGATTCCCATGCTCGCTGAAGGTGCTGTTTTAAGCACTTTCTGTCTCTTCTCCTGACTTGAAATACTACAA
ACAAAATATTAAATGAAATTTGCTAAAGTTATCCTGCCTCACGCGGGACAAAAAAAAANNGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 91559111..91559328 218
 
EST/CDNA Est Name
  CN669289.1

 
Come back to gene CN669289.1


For any suggestions or comments, please send an email to unitrap@crg.es