Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0454
Clone ID AG0454
Vector pGT0lxr
Project sanger

Sequence tag AG0454
Sequence
GAAGTTCATGCAAAGAGGCCTGGACTCGGAAACCAAGAAACAGCTAGAAGAGGAGGAGCGGAAGATGATCAGCGACGAGC
ATTGGTACCTGGATTTGCCGGAGTTGAAGGTGAAGGAGAGCTTCCTCGTAGAGGAGCAGAGCTTCTCCCTGTGTGAAGAT
CTTCTCTACGGAAGGATGTCATTCAGGGGG
Sequence Type mRNA
Unitrap ID UNI2117

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 120318499..120323058 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031843 (Mphosph6) NM_026758 M phase phosphoprotein 6 Gene [Source:MGI Symbol;Acc:MGI:1915783]

 
Come back to gene ENSMUSG00000031843


For any suggestions or comments, please send an email to unitrap@crg.es