Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_267F8-3
Clone ID CMHD-GT_267F8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_267F8-3
Sequence
GGTACCTGCTTTTCCTGGACTTCTGCCTGAACCATCTGGAACAGGCCAAGCCCTTGGTGGAGTTCTACG
Sequence Type mRNA
Unitrap ID UNI13770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4292772..4292840 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024858 (Adrbk1) NM_130863 adrenergic receptor kinase, beta 1 Gene [Source:MGI Symbol;Acc:MGI:87940]

 
Come back to gene ENSMUSG00000024858


For any suggestions or comments, please send an email to unitrap@crg.es