Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_267F4-3
Clone ID CMHD-GT_267F4-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_267F4-3
Sequence
GAGCCTTGTCTGAGCCCTATGAGGGCCTAGAGGCCGAAGAGTGTGGTATCCTGGATGGCTGCCCTCACGGCCGCTGTGTA
CGCGTTCCAGAAGGCTTCACCTGCGATTGTTTCGATGGCTACCGCCTGGACATCACCCGCATGTCCTGTGTCGACGTCAA
CGAGTGTGATGAGGCAGAGGCAACCTCCCCACTCTGCATCAATGCGCGCTGTGTCAACACTGACGGCTCCTTCCGCTGTA
TCTGTCGTCCAGGATTTGCTCCCACGCATCAGCCACATCACTGTGCGCCTGCTCGACCCCGGGCCTGAGCAGGGGTGCCA
AATCTCCCACTATACCTGAGCACCGGGAGCTTCCAGAGCACGCCTGCCTCCCTCCCTCTAGTCTGCATGTGTGCAAGGAT
GTCAGACAGTCTCGACTTAGGATGGACAGACACAGAGGGGTGCCTTCTATGGTGCCAGCCTGTCATGCCCAGTCCCTCCC
ATCAGTGCCCTGGGCCTGTCCTGGGTCCCCTGACACATTACTTGCCCTTTTATACAATTTTCAATTAAAACACCTATTTT
GT
Sequence Type mRNA
Unitrap ID UNI13716

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28090161..28091238 402
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es