Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14481G5
Clone ID IST14481G5
Vector VICTR74
Project tigm

Sequence tag IST14481G5BBF1
Sequence
GGTGTTGTTTTCTCTGACCNTCCTCTGTTTGGACAGATTGGTCCCTTTGTAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI18589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13195413..13195468 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038515 (Grtp1) NM_025768 GH regulated TBC protein 1 Gene [Source:MGI Symbol;Acc:MGI:1914040]

 
Come back to gene ENSMUSG00000038515


For any suggestions or comments, please send an email to unitrap@crg.es