Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10815A11
Clone ID IST10815A11
Vector VICTR76
Project tigm

Sequence tag IST10815A11HMR1
Sequence
AANAATGANNACTCCNCCTTACAGTTTCANCANAAATCAAGTTAGAGGAAGGAAANAATGTGAANACTGTGAAGGGAACA
TTANAAAGAACANAGCAAAGGTCAGTGAAAGCAACAGTACGGGGAAAGTCACAACACCANCGGGCGCCTGCTTTACCTTA
TCGTTAGGCTCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10815A11HMF1
Sequence
GGATAGATGTTTTTTTGTTTTTTGTTTTTTGTTTTTTTACTAAATTANAGACAATAGTTTTTAAAAGATCAGGTTGTAGT
TTTTCTGAGACAGGAATAAAAGAGGCAGATGTTCAGTAGCCATGAAGGCTAGCTTGTGGGAGTGCTGAAAACATAGCCTG
GAGCAAAAGGGGCTTTCTAACTGGGCTCTTGGCAATGGGGCTGCTTATTAACTTTTCTGACTCCTTCCTTGCTATCTACT
GTTCTNCATATAANCANACTAAGAGGAGACTGGAACTCCATTTNAGGCAACTGATANAGCCGGANAGATAACTTCTGAGC
AGATTTTCTCTTCTAGCANTTCTGCANGGCTATTTTTAACACTCAAGTGCTTNGGGCTGTGAAAATTCTGGAATGCAAGG
GGGACTATTTAAAGTGCAGCTGGCGGGNCAGGGGNNAAAGAAGGGTGCNNANCCTGTGTGTAAATGAATNAACTCGTGAG
AAGTTTNAGTAAACTACTTCAGCTTTTACTAACATTCCTGACGCN
Sequence Type genomic DNA
Unitrap ID UNI32541

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 76644418..76644943 480
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051747 (Ttn) NM_011652 titin Gene [Source:MGI (curated);Acc:Ttn-019]

 
Come back to gene ENSMUSG00000051747


For any suggestions or comments, please send an email to unitrap@crg.es