Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14940A8
Clone ID IST14940A8
Vector VICTR76
Project tigm

Sequence tag IST14940A8BBF1
Sequence
GATTTTCTGCAACTTGAGCTCTATTGCTACAAGAGAGAAGATTCTCCTCAAGGACACACTTAGCAACTTTTAGATCGTTT
ACTTGTGTCTGGAGCCTTTCGATTTTATCACACAACTCCTTCCTTTCATTCATCATTTTTTCCACAGATACTAAGAGCAG
CCAGCCAGTAAAATCATTTTTCGATTTTTTCCCCATCTTGTAGAAAGCTTTGTGCACTGAATCACCTAATTCATTAAGAA
AATCAAGGGCATTAGCTTCTTTAAGTTCGGAATATAGTTTCAACCATGGGTCTTCAAAATTCTCTGAGCTCCCAGGAGGG
AGAGAATCTGGAGAGGTTTCAATATTTGAAAGTGCTGGTGGATCAACAAGCCAATTCCAGTATTTTAAAAGATTCATCCT
TGTACTTCTGTTACTCTANNACCNCTCCTGGTACCNACTTCTGTATNAGTCANGGTTCNNTAGAGTCACANAACTNANGG
ATAATTTCTN
Sequence Type genomic DNA
Unitrap ID UNI9273 UNI26363

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 39758014..39758502 467
 
EST/CDNA Est Name
  BB709166.1 - AI892095.1 - AI664309.1 - AA146215.1 - AI876125.1 - AI226979.1 - BY089116.1 - BY084573.1 - AA675403.1 - CV677060.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 76342986..76343474 467
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36616552..36617040 467
 
EST/CDNA Est Name
  AA656659.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 76800872..76801360 467
 
EST/CDNA Est Name
  BF531478.1 - BB328122.2
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 58535402..58535890 467
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 25932817..25933305 467
 
EST/CDNA Est Name
  BU514051.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20429095..20429583 467
 
EST/CDNA Est Name
  BU563801.1 - AV206190.2
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 107551952..107552440 467
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4760411..4760899 467
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15697486..15697974 467
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11075884..11076372 467
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5173718..5174206 467
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32982236..32982724 467
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84885687..84886175 467
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028488 (Sh3gl2) NM_019535 SH3-domain GRB2-like 2 Gene [Source:MGI (curated);Acc:Sh3gl2-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 140428960..140429448 467
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17875956..17876444 467
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16247352..16247840 467
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16615230..16615718 467
NO GENE  


Sequence tag IST14940A8HMF1
Sequence
GATTTTCTGCAACTTGAGCTCTATTGCTACAAGAGAGAAGATTCTCCTCAAGGACACACTTAGCAACTTTTAGATCGTTT
ACTTGTGTCTGGAGCCTTTCGATTTTATCACACAACTCCTTCCTTTCATTCATCATTTTTTCCACAGATACTAAGAGCAG
CCAGCCAGTAAAATCATTTTTCGATTTTTTCCCCATCTTGTAAAAAGCTTTGTGCACTGAATCACCTAATTCATTAAGAA
AATCAAGGGCATTAGCTTCTTTAAGTTCGGAATATAGTTTCAACCATGGGTCTTCAAAATTCTNTGANCTCCNNGGAGGG
ANANAATCTGGNNAGGTTNNNNTNNTTNANNGTGCTGGTGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14940A8HMR1
Sequence
AATNNAACAGAAACTCTCATTGTAAGGTTGGCTGAACTACAGAGAAAATTCN
Sequence Type genomic DNA
Unitrap ID UNI19317 UNI22305

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3162299..3162349 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3054182..3054232 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 8525038..8525088 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3765175..3765225 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 80976828..80976878 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6940492..6940542 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 12867164..12867214 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7977417..7977467 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30498869..30498919 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 65124559..65124609 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4760896..4760946 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15697439..15697489 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 37924691..37924741 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5174203..5174253 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20330334..20330384 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3302063..3302113 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 23940775..23940825 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 39240632..39240682 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 68756738..68756788 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027035 (Lass6) NM_172856 LAG1 homolog, ceramide synthase 6 Gene [Source:MGI (curated);Acc:Lass6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 34136132..34136182 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026131 (Dst) NM_133833 dystonin Gene [Source:MGI Symbol;Acc:MGI:104627]

 
Come back to gene ENSMUSG00000026131


For any suggestions or comments, please send an email to unitrap@crg.es