Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12235A4
Clone ID IST12235A4
Vector VICTR76
Project tigm

Sequence tag IST12235A4BBF1
Sequence
CTGGGATCTTCCAGCCTCCATCCCTCCCAGGGTTGGAGTTACAGGTACTCACCACTCAGCTTTTCGGTGGTGCTCCAGTC
TTTGTAGTTAAAAATGAATAAATCCTGGCGTGGGGTTACGACCCACCGAATGAAAGACACACACAGCCTTTATATTTTAA
TATGCCTTAAGTAGCTCAATAGCTGGGCAACTGCCTCCCCTCCATGCTGTTAAGAGACCACTTTCCCATCAATAACTCCA
AGTGACTACTTACTAATTTCTAGGTTTCATCCTGGCTGCTCTTAATTCCAATTAGTCAGCCCTCTGGGCCACGTTCTCTT
GGCCCAGAGCCCAGGGAGCTCTCCTTGCTTCTCTACTCCATGGTGACTTCCATCTCTCTCCTGCCTGTTGGAAGCCTTCC
TGTGGCTCACAAGAAACACCTGGGANGCAAGCAGGGGCTGAAAAGGGAGGGGAACTANGCGGTCGAGANAAAAATGGAGC
TNAGTCNAGATTCCTGATCAAAGCTNAAATGTTTAATGGCAAATGCCCTTATAAAGTGGGGGGAGGCCCATTCCCACN
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6056930..6057485 541
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


Sequence tag IST12235A4HMF1
Sequence
CTGGGATCTTCCNNCCNNNNTCCCTCCCAGGGTTGGAGTTACAGGTACTCACCANTNAGNNNTNNNGTGGTGCTCCANTC
TTTGTANTTAAAAATGAATAANTCCTGGCGTGGGGTTACNACCCACCGAATGAAAGACACACACNNCCTTTATATTTTAA
TATGCCTTANNTANCTCANTANCTGGGCAANTGNCNCCCCTCCATGCTGTTAAGAGACCACTTTCCCATCAATAACTCCA
AGTGACTACTTACTAATTTCTAGGTTTCATCCTGGCTGCTCTTAATTCCAATTAGTCAGCCCTCTGGGCCACGTTCTCTT
GGCCCAGANCCCAGGGAGCTCTCCTTGCTTCTCTACTCCATGGTGACTTCCATCTCTCTCCTGCCTGTTGGAAGCCTTCC
TGTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es