Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13401A11
Clone ID IST13401A11
Vector VICTR74
Project tigm

Sequence tag IST13401A11HMF2
Sequence
CCTGGAAGTCCAGCTCCAGGGGATGCTGTACCTGAGGTCTCTGAGGGCACCTGTGCTCATGTACACACAGCTCCCCACAC
ACAATTATGAANAAAATCAATCAGTCTTTAAATAAAAGACAAACACCCACGACCTCACTCATGCANAAGCTGAAGCTGTT
TTCTCCTAGGAACAGTAAGATGCCGGTTACTGGGGTTTGAGTGGCGGAGGCTGGATGTGCAGCGCCATCGTTC
Sequence Type genomic DNA
Unitrap ID UNI31160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28625962..28626193 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074243 (AC164532.4-202)  


Sequence tag IST13401A11BBF1
Sequence
CAACTATATATGAATGTATGGCAAGTATTTGTATTTTATGTTGTTATTACTTCACATACTCTCATACGTGTGACTTGAAT
TTTTCTCTTTTATTTCAACAGTCTAATTANCATGAACATCATAAATTAAAGAACGGGAGGGAAGTGTTAATATAACAATG
TTTCTTTTTGATTCNCTGACAATCTGATATATGACGGTGACATATTTTTTTACTGAAAATAGTTATCTCCAGAATCTACA
AGCACGGGATGTGTGTTTTACATAAATGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23700438..23700711 270
 
EST/CDNA Est Name
  AA959341.1 - CJ186023.1 - CA546592.1 - CA547310.1 - BY304199.1 - CX202828.1 - AW476325.1 - BY018554.1 - CA545784.1 - BY011236.1 - CA547684.1 - AA822757.1 - BY037052.1 - BY341269.1 - BY009213.1 - BY083204.1 - BY021051.1 - BY020472.1 - BY267971.1 - BY066458

 
Come back to gene AA959341.1 - CJ186023.1 - CA546592.1 - CA547310.1 - BY304199.1 - CX202828.1 - AW476325.1 - BY018554.1 - CA545784.1 - BY011236.1 - CA547684.1 - AA822757.1 - BY037052.1 - BY341269.1 - BY009213.1 - BY083204.1 - BY021051.1 - BY020472.1 - BY267971.1 - BY066458


For any suggestions or comments, please send an email to unitrap@crg.es