Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0636
Clone ID GC0636
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0636
Sequence
CACGTGCTCTCTGTTGTTGCTGCGCTTGCCATTCCAGGAAGCGGGCCG
Sequence Type mRNA
Unitrap ID UNI210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74644856..74644903 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000282 (Mnt) NM_010813 minute imprinted gene in the Igf2 region Complex/Cluster/Region [Source:MGI (curated);Acc:Mnt-001]

 
Come back to gene ENSMUSG00000000282


For any suggestions or comments, please send an email to unitrap@crg.es