Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14178F9
Clone ID IST14178F9
Vector VICTR74
Project tigm

Sequence tag IST14178F9HMF1
Sequence
ATAGTACACTGAAAGTTCTTTGCTAAAGTTACATGGCTTCAGTAAAATTTGCTTAGCTTTAGAGAAAATCTCATTGAGGT
AGGGGCGGGTCATTCATGTTTCCGTGTGTACACATATACATACACACGCACAGAGATACACACACACACACACACACACA
CNTGCCTTTGTCTCCNGAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 87440267..87440446 176
NO GENE  


Sequence tag IST14178F9HMR1
Sequence
CTATGTAGACCNGGCTGACCTCGGACTCACTGAGATAATCCCTACCTCTGCCTCCCAAGTACTGGAATTAAGGACCTGTG
CTACTACAGCTGGCAATCCACCCATCTTTTTAAGCATTGATGCCACACGTTTTTGTTTTTGTTCTTCCTANACAGGATTT
CTCCGTGTATCCCTTCCTGGTTGTCCTGGTATACACTCTGTANACCAGGCTGCCCTTGAACTCANANATCCATCTGAGTG
CTGGGACTAAAGACATGTGCCNCCACTGCCTGACTGGN
Sequence Type genomic DNA
Unitrap ID UNI17406

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 87439994..87440270 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041079 (Rwdd2b) NM_016924 RWD domain containing 2B Gene [Source:MGI (curated);Acc:Rwdd2b-001]

 
Come back to gene ENSMUSG00000041079


For any suggestions or comments, please send an email to unitrap@crg.es