Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10274G7
Clone ID IST10274G7
Vector VICTR76
Project tigm

Sequence tag IST10274G7BBF1
Sequence
ACACAAGGACTGGGGTGTGGTGGCTCACACCCGTGCTCCTANCACTGGGGGTGTTGGGAGGAGGCAGGGCGAAAAGTTTT
CTGCAAATTCGATGACCACATGTGATACACAATGAATCTCAGGCCTTCAAGGCTGCATAGTGAGACCGCCAGACTGGTCT
ACGTAATGAGTGCTAGACCAGTCAAGGTGGCATANTGAGACCCTGTTTCAAAAACAAACAGGGGCTGGGGAGAGGGTTCC
TTGGTTAAGGGCACTANTTGCTCTTGCGGAGGACCCAGGTTCGATTCCCATGGCCCACGTGGTGGCTCACAACCATCTCT
AACTCCGGTTCTAAGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI18102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30951154..30951493 334
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST10274G7HMF1
Sequence
ACACAAGGACTGGGGTGTGGTGGCTCACACCCGTGCTCCTANCNCTGGGGGTGTTGGGAGGAGGCAGGGCGAAAAGTTTT
CTGCAAATTCNATGACCACATGTGATACACAATGAATCTCAGGCCTTCAAGGCTGCATAGTGAGACCGCCAGACTGGTCT
ACGTAATGAGTGCTAGACCAGTCAAGGTGGCATANTGAGACCCTGTTTCAAAAACAAACAGGGGCTGGGGAGAGGGTTCC
TTGGTTAAGGGCACTANTTGCTCTTGCGGAGGACCCAGGTTCGATTCCCATGGCCCACGTGGTGGCTCACAACCATCTCT
AACTCCGGTTCTAANGGATCCAANGTCTCTTCTGACCTCCCTGGATCCAAAGCACAAGTGTGGCATGGATATATGAATGC
ANACAAAATGCTCATACAGATAAAAATAAATATAAAGCANACAAAATTAGNNCCNNGCGGGACAGTGCACACNNNANGGN
Sequence Type genomic DNA
Unitrap ID UNI18102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30951022..30951493 446
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es