Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14899D3
Clone ID IST14899D3
Vector VICTR76
Project tigm

Sequence tag IST14899D3HMF1
Sequence
ACTCCTCTCTGCCAGAAAAAAGACTCTCCCTTACGTGATGGGAGGGGGACGTGCAGACTCATGGTCTCGGGATCAAAACA
ACTCTGAGAAACCACAGAGAGCCAGATGAAGAACAGCGTGGAAGGCTCTGACTGGAGTTAGAAGCCGCAACACTTANAAC
TGCAGGTTTGGGAACGGCTGGGCAGAATCCAGAGCTGAGATATCCCTGAGCCTGCAGCCTCTGCCTTCTCTGAAGATGGG
TAGCCTGGTCTGGAGGGGATGCCTATGGCCCTGGCAAGGCTTCCATGCTAGGGGGGCTGAAGCCNAAGGCTCAAGATGGG
CTCAGCTCAGCTGTGGGCAGTTGACGAAAGAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101212371..101212727 353
NO GENE  


Sequence tag IST14899D3HMR1
Sequence
GAGTGTGTAAGTTANGAAACACAGGTGCTTTGAATTGCACAGTTCTTGGAATTAACAGTCTTGGAGCTCANATGAGATTT
TTAAGGATTATCTATGTTCCTTTTTTTNNTG
Sequence Type genomic DNA
Unitrap ID UNI11370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101212724..101212830 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042035 (Igsf3) NM_207205 immunoglobulin superfamily, member 3 Gene [Source:MGI Symbol;Acc:MGI:1926158]


Sequence tag IST14899D3BBF1
Sequence
ACTCCTCTCTGCCAGAAAAAAGACTCTCCCTTACGTGATGGGAGGGGGACGTGCAGACTCATGGTCTCGGGATCAAAACA
ACTCTGAGAAACCACAGAGAGCCAGATGAAGAACAGCGTGGAAGGCTCTGACTGGAGTTAGAAGCCGCAACACTTAGAAC
TGCAGGTTTGGGAACGGCTGGGCAGAATCCAGAGCTGAGATATCCCTGAGCCTGCAGCCTCTGCCTTCTCTGAAGATGGG
TAGCCTGGTCTGGAGGGGATGCCTATGGCCCTGGCAAGGCTTCCATGCTAGGGGGGCTGAAGCCNAAGGCTCANNATGGG
CTCANCTCAACTGTGGGCNNTTGACGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101212381..101212727 333
NO GENE  

 
Come back to gene ENSMUSG00000042035


For any suggestions or comments, please send an email to unitrap@crg.es