Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14858B12
Clone ID IST14858B12
Vector VICTR76
Project tigm

Sequence tag IST14858B12HMR1
Sequence
NNGGAACATGGAGTAATAACTCTTATTTGTTAATTTGGAAACCATGGCAACACAATAAATATTATGCCTCTTAATTTGTT
CTTCAGTGTTCTTTTGGCCCGAGTGCCATGGAAGAATAAACAAAATTAACAGTAAATGCTGAGCACGCACTACCTGAGTT
AGTCATTTTTCTTGATGGTTTCACTCTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI7156

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 111050620..111050811 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032497 (Lrrfip2) NM_027742 leucine rich repeat (in FLII) interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1918518]


Sequence tag IST14858B12BBF1
Sequence
CTAGCAACTTCACTTCAATCCAAAATGTGAGGTGTCCTTTTTCTTAATTAGACCTTGAAATGTATAGTGTTTAACAATTT
AAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 111050520..111050620 101
NO GENE  

 
Come back to gene ENSMUSG00000032497


For any suggestions or comments, please send an email to unitrap@crg.es