Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14433D6
Clone ID IST14433D6
Vector VICTR74
Project tigm

Sequence tag IST14433D6HMR1
Sequence
AGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGCACA
Sequence Type genomic DNA
Unitrap ID UNI9937 UNI29633 UNI32242 UNI33441 UNI33802

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161902: 447228..447262 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 77844..77878 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053211 (Zfy1) NM_009570 zinc finger protein 1, Y linked Gene [Source:MGI Symbol;Acc:MGI:99212]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 45723133..45723167 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 77437842..77437876 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025425 (St8sia5) NM_153124 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5 Gene [Source:MGI (curated);Acc:St8sia5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 9450513..9450547 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 30117970..30118004 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 54159061..54159095 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 21321549..21321583 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8092463..8092497 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69106806..69106840 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75673212..75673246 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032179 (Bmp5) NM_007555 bone morphogenetic protein 5 Gene [Source:MGI (curated);Acc:Bmp5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 34659129..34659163 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 70808695..70808729 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 60613162..60613196 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 35009767..35009801 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29994637..29994671 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6703503..6703537 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 35340797..35340831 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 56248611..56248645 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 68955255..68955289 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59591807..59591841 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74463193..74463227 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026175 (Vil1) NM_009509 villin 1 Gene [Source:MGI Symbol;Acc:MGI:98930]

 
Come back to gene ENSMUSG00000026175


For any suggestions or comments, please send an email to unitrap@crg.es