Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14575E9
Clone ID IST14575E9
Vector VICTR74
Project tigm

Sequence tag IST14575E9HMR1
Sequence
ACGGTAGTTACTTCCCAGCTACCTGGACTTTACCTATTCATTTTTATATCTATACTGGCAGAGTTACATT
Sequence Type genomic DNA
Unitrap ID UNI12335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127385882..127385951 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031984 (2810004N23Rik) NM_025615 RIKEN cDNA 2810004N23 gene Gene [Source:MGI Symbol;Acc:MGI:1913773]


Sequence tag IST14575E9HMF1
Sequence
CCGTAATGAATTCCTGCATGTGTGAATATCAACTGTATCTAGGATTTTAAAAATTAGTCTTAAAACTTGTGAAAGTCAGC
CAGGTGGTGGTGGTGGCGGCGGCGCACGACTTTAATCCCAGCACTTGGGAGACAGAGGCAGGCGGATTTCTGAGTTCGAG
GCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTTGAAAAACCAAAAAGAAAA
AAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127385948..127386197 250
 
EST/CDNA Est Name
  BB856728.1 - AA204567.1 - AA204575.1 - BY769605.1 - BY009324.1 - BY142881.1 - BY034487.1 - BY100344.1 - BY016986.1 - BY090768.1 - BY316118.1 - BY102936.1 - BY324513.1 - BY114077.1 - BY336006.1 - BY104135.1 - BU563758.1


Sequence tag IST14575E9BBF1
Sequence
CCGTAATGAATTCCTGCATGTGTGAATATCAACTGTATCTAGGATTTTAAAAATTAGTCTTAAAACTTGTGAAAGTCAGC
CAGGTGGTGGTGGTGGCGGCGGCGCACGACTTTAATCCCAGCACTTGGGAGACAGAGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127385948..127386085 138
 
EST/CDNA Est Name
  BU563758.1

 
Come back to gene BU563758.1


For any suggestions or comments, please send an email to unitrap@crg.es