Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14601A8
Clone ID IST14601A8
Vector VICTR74
Project tigm

Sequence tag IST14601A8BBF1
Sequence
CATGGTAATCTAGGATTCCTGCTAATGCACAGGTAGTGGTGGGGTGGGGGGCAGAGAGGCAGCTTTGGTTCACCAGAGCT
TTGTCTCATCACAAAACAAGGTTTCCAGGACCCTGGGGACCCTTCTAACTGCAGCTGAAACCACAGTCTCTTGCAATGTT
ACTGCCTCGTCTAAAGGCAAGTGCCTCTANCCTGGGCCAGGTTTCTTTGTCTCCTGTCTAATGTANCANGCCATTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71557999..71558234 230
NO GENE  


Sequence tag IST14601A8HMR1
Sequence
NNGGAATTTAACAGGTACATGAACATGAAGCATGTGTACATGTTGAAC
Sequence Type genomic DNA
Unitrap ID UNI33807

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71558234..71558278 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064263 (Gm1631) NP_958754 gene model 1631, (NCBI) Gene [Source:MGI (curated);Acc:Gm1631-001]


Sequence tag IST14601A8HMF1
Sequence
CATGGTAATCTAGGATTCCTGCTAATGCACAGGTAGTGGTGGGGTGGGGGGCANAGAGGCAGCTTTGGTTCACCANAGCT
TTGTCTCATCACAAAACAAGGTTTCCAGGACCCTGGGGACCCTTCTAACTGCANCTGAAACCNCANTCTCTTGCAATGTT
ACTGCCTCGTCTAANGGCNNNTGCNTNTANCCTGGGCCANGTTTNTTTGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000064263


For any suggestions or comments, please send an email to unitrap@crg.es