Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11028A5
Clone ID IST11028A5
Vector VICTR76
Project tigm

Sequence tag IST11028A5BBF1
Sequence
CAAGNGAACAGCAAAGCTCCGAGCTGATCACTCCTGCAAACTGCCTACATTTGATTTTTATTAGTGACTTAAAGCTTCCT
TTTTTTTCTTTATTGTCCTGGGTGAACCAAAATGCATTTTAATGCCTGCTATTCAGGCCAGATGAGAAATACCTACAGAC
CCCCTGCACAAGCCAGCCATATTGGTGTCTCTCTCTAGGACCGGGGGTGGTGGTGTAGGAGGGANAAAGACCAAACTAAC
TCTTGGACAGAACAGGTCAGGGACTGAGGCCACTGACTGCGTATCTCCCTTGTGTANAGGCCTCCAGGTACAGCAAATTG
CCTTCTTCCTTGAGGCANAGACTAAACNNAGTTAAGGTAGTGGTGATCAATATGTATCCCATGTTTGCAGTGTGATGCGG
TTACTTTGGGCATCTCTCANGTTACTTCACATAATCTTCCCAGCAACTGGGAANTGGGCNANTATCCTTAAGATCCCTTT
TTTGNAANANGAAACCAAACCTCANAAAAGTCN

Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117048243..117048754 484
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST11028A5HMF1
Sequence
CAAGAGAACAGCAAAGCTCCGAGCTGATCACTCCTGCAAACTGCCTACATTTGATTTTTATTAGTGACTTAAAGCTTCCT
TTTTTTTCTTTATTGTCCTGGGTGAACCAAAATGCATTTTAATGCCTGCTATTCAGGCCAGATGAGAAATACCTACAGAC
CCCCTGCACAAGCCAGCCATATTGGTGTCTCTCTCTAGGACCGGGGGTGGTGGTGTAGGAGGGAGAAAGACCAAACTAAC
TCTTGGACAGAACAGGTCAGGGACTGAGGCCNCTGACTGCGTATCTCCCTTGTGTAGAGGCCTCCAGGTACAGCAAATTG
CCTTCTTCCTTGNNGCAGAGACTAAACCAAGTTAAGGTAGTGGTGATCAATATGTATCCNATGTTTGCAGTGTGATGCGG
TTACTTTGGGCATCTCTCAGGTTACTTCACATAATCTTCCCAGCAACTGGGAANTGGGCNANTATCCTTAANATCCCTTT
TTTGGAANANGAAACCAAACCTNANAAAAGTCNANGGAACTTAATGAAAGCCNCNCAGCTNGTGNCNNNCTNGGNTN
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117048212..117048754 508
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es